ID: 932431098_932431109

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 932431098 932431109
Species Human (GRCh38) Human (GRCh38)
Location 2:71674042-71674064 2:71674066-71674088
Sequence CCTTCCCAGTCTTCCCACAGGAC TGGCTCTGGCAGGTCCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 335} {0: 1, 1: 0, 2: 1, 3: 20, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!