ID: 932658979_932658982

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 932658979 932658982
Species Human (GRCh38) Human (GRCh38)
Location 2:73635771-73635793 2:73635806-73635828
Sequence CCAAAGTATAGAAAACCAATCCA AAAAGATATATTGTGCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 266} {0: 3, 1: 1, 2: 2, 3: 43, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!