ID: 932739745_932739754

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932739745 932739754
Species Human (GRCh38) Human (GRCh38)
Location 2:74282571-74282593 2:74282612-74282634
Sequence CCCTTCTAGAAACATCCTCATCT CACTGGGTCTGGAGTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 245} {0: 1, 1: 0, 2: 6, 3: 49, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!