ID: 932740215_932740222

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932740215 932740222
Species Human (GRCh38) Human (GRCh38)
Location 2:74285473-74285495 2:74285488-74285510
Sequence CCTGGAACCAGTGCCCTATGGAT CTATGGATATGGAGGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 52, 3: 346, 4: 850} {0: 1, 1: 0, 2: 0, 3: 32, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!