ID: 932749091_932749095

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932749091 932749095
Species Human (GRCh38) Human (GRCh38)
Location 2:74359906-74359928 2:74359922-74359944
Sequence CCCCATTCTCCTTTCAAAGTGCC AAGTGCCACCAGAAGTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 78, 4: 984} {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!