ID: 932760893_932760906

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 932760893 932760906
Species Human (GRCh38) Human (GRCh38)
Location 2:74438589-74438611 2:74438638-74438660
Sequence CCTTCAAGGCCCTGCATGATCTG CTACTATATTCCAGCCACACTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 67, 3: 240, 4: 718} {0: 1, 1: 0, 2: 16, 3: 107, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!