ID: 932763708_932763711

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932763708 932763711
Species Human (GRCh38) Human (GRCh38)
Location 2:74457414-74457436 2:74457429-74457451
Sequence CCTCACAGAGGAGATGCTGCTGA GCTGCTGAAGCGCGAGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 300} {0: 1, 1: 2, 2: 1, 3: 25, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!