ID: 932766643_932766650

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 932766643 932766650
Species Human (GRCh38) Human (GRCh38)
Location 2:74474746-74474768 2:74474789-74474811
Sequence CCAGGCTATTGAGGCAGCTGCTG CTCCTGACAAGCACCTGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 244} {0: 1, 1: 0, 2: 1, 3: 19, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!