ID: 932772331_932772343

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932772331 932772343
Species Human (GRCh38) Human (GRCh38)
Location 2:74507521-74507543 2:74507568-74507590
Sequence CCGCCCCAATTCGCACCGCTGGC CCTTGCACCTCGTTCCGTAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58} {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!