ID: 932774936_932774943

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 932774936 932774943
Species Human (GRCh38) Human (GRCh38)
Location 2:74522708-74522730 2:74522753-74522775
Sequence CCATCATCATCCAGGGCTGCCAG TGCATCAGTGCTTCTGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 270} {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!