ID: 932788618_932788623

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 932788618 932788623
Species Human (GRCh38) Human (GRCh38)
Location 2:74632348-74632370 2:74632390-74632412
Sequence CCTAGCTCTGGTACTTTCATTTC CCTTGGGCCAAGTCCTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 271} {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!