ID: 932840235_932840238

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932840235 932840238
Species Human (GRCh38) Human (GRCh38)
Location 2:75074953-75074975 2:75074994-75075016
Sequence CCAGGATGGTTGGTCACTTTAGA CTGCTGTCATTTTCCCTCACTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 8, 3: 47, 4: 204} {0: 1, 1: 0, 2: 2, 3: 13, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!