ID: 933046101_933046104

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 933046101 933046104
Species Human (GRCh38) Human (GRCh38)
Location 2:77539281-77539303 2:77539308-77539330
Sequence CCTAGAGACTTGTTAAATTGTTG CAAAATGCTGATTGTGATATGGG
Strand - +
Off-target summary {0: 65, 1: 93, 2: 200, 3: 783, 4: 2563} {0: 1, 1: 39, 2: 82, 3: 83, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!