ID: 933111045_933111047

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 933111045 933111047
Species Human (GRCh38) Human (GRCh38)
Location 2:78400705-78400727 2:78400718-78400740
Sequence CCCTATTGACACTATTGCATAAG ATTGCATAAGATAGAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 21, 4: 112} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!