ID: 933239766_933239769

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 933239766 933239769
Species Human (GRCh38) Human (GRCh38)
Location 2:79907152-79907174 2:79907199-79907221
Sequence CCTGAAATCTTAAAGCAGAACAT AATATGGTTTTCTATAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 296} {0: 1, 1: 1, 2: 4, 3: 62, 4: 700}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!