ID: 933254840_933254848

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 933254840 933254848
Species Human (GRCh38) Human (GRCh38)
Location 2:80069171-80069193 2:80069221-80069243
Sequence CCCTTTTTCCACCTTTATGTTCT GCCCTAATGCTTGTGCACACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 20, 3: 170, 4: 1069} {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!