ID: 933264731_933264739

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 933264731 933264739
Species Human (GRCh38) Human (GRCh38)
Location 2:80169578-80169600 2:80169606-80169628
Sequence CCCTGCTCTATCTGTTTCTGTGG ACTCTGTGGGTAGGAGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 402} {0: 1, 1: 0, 2: 3, 3: 23, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!