ID: 933271971_933271978

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 933271971 933271978
Species Human (GRCh38) Human (GRCh38)
Location 2:80242723-80242745 2:80242765-80242787
Sequence CCTCCCTTATCCAGATAGGGCAG GAGCTGTTCCTCTGCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 26, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!