ID: 933272598_933272602

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 933272598 933272602
Species Human (GRCh38) Human (GRCh38)
Location 2:80249210-80249232 2:80249242-80249264
Sequence CCTTTTATTTATCCTTCCTCTGA TAGAGTTCTAAAGAACCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 683} {0: 1, 1: 0, 2: 0, 3: 15, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!