ID: 933355042_933355049

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 933355042 933355049
Species Human (GRCh38) Human (GRCh38)
Location 2:81199329-81199351 2:81199353-81199375
Sequence CCTCTGGCTTGGCCCTGCAGTCC TGTGCTCCTTGGAGCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 313} {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!