ID: 933483148_933483149

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 933483148 933483149
Species Human (GRCh38) Human (GRCh38)
Location 2:82882558-82882580 2:82882591-82882613
Sequence CCAGGCTGTGTGTGTGAGAAATA ATTCTCATTTGTCCAGCATCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!