ID: 933666896_933666908

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 933666896 933666908
Species Human (GRCh38) Human (GRCh38)
Location 2:84971369-84971391 2:84971402-84971424
Sequence CCGGCGCGGGCAGCGCCGGGACC CACTGCAGCCGGAGCCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 190} {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!