ID: 933698088_933698098

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 933698088 933698098
Species Human (GRCh38) Human (GRCh38)
Location 2:85235354-85235376 2:85235406-85235428
Sequence CCCGAAGCCATTTCTTTATCCTA TTGGTTTATCACCACCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 319} {0: 1, 1: 1, 2: 7, 3: 142, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!