ID: 933714601_933714607

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 933714601 933714607
Species Human (GRCh38) Human (GRCh38)
Location 2:85350841-85350863 2:85350866-85350888
Sequence CCCTGAATGTAGGCTTTCTCTCC TGTACATGGGGTACTCCTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 275} {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!