ID: 933721066_933721082

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 933721066 933721082
Species Human (GRCh38) Human (GRCh38)
Location 2:85398172-85398194 2:85398206-85398228
Sequence CCTGATCTCACCCCCCACACACC CAGCCTGAGGAGGGGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 454} {0: 1, 1: 1, 2: 6, 3: 130, 4: 1166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!