ID: 933724558_933724565

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 933724558 933724565
Species Human (GRCh38) Human (GRCh38)
Location 2:85419096-85419118 2:85419119-85419141
Sequence CCTGTGTGGCCGGCAGGACTCGT GGTGAAGCCCGGGGAAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 68} {0: 1, 1: 0, 2: 2, 3: 53, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!