ID: 933762853_933762858

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 933762853 933762858
Species Human (GRCh38) Human (GRCh38)
Location 2:85685196-85685218 2:85685211-85685233
Sequence CCTAAGGGAGTCCAGCTGGAAGG CTGGAAGGAAGGTAAAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 169} {0: 1, 1: 0, 2: 7, 3: 46, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!