ID: 933774318_933774325

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 933774318 933774325
Species Human (GRCh38) Human (GRCh38)
Location 2:85762725-85762747 2:85762753-85762775
Sequence CCATGCTCTGGAATAGGGATTTC TTGGCACTATCGACATTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 245} {0: 1, 1: 1, 2: 8, 3: 25, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!