ID: 933844140_933844145

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 933844140 933844145
Species Human (GRCh38) Human (GRCh38)
Location 2:86311687-86311709 2:86311729-86311751
Sequence CCAACTTGATTACATTTGCAAAG TCACATTCTAAGGTTCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 31, 4: 267} {0: 3, 1: 38, 2: 104, 3: 233, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!