ID: 933897446_933897459

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 933897446 933897459
Species Human (GRCh38) Human (GRCh38)
Location 2:86824573-86824595 2:86824614-86824636
Sequence CCCTTCCTGGGGTCCTGTGGGGA CCCTGGGTCAGGGAAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 300} {0: 1, 1: 0, 2: 9, 3: 68, 4: 540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!