ID: 933909522_933909526

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 933909522 933909526
Species Human (GRCh38) Human (GRCh38)
Location 2:86927600-86927622 2:86927632-86927654
Sequence CCTGAACTGAGTGCTGTGGGGGT AAGGCTTCTGGGAGACATCATGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 12, 4: 173} {0: 3, 1: 0, 2: 2, 3: 20, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!