ID: 934305777_934305790

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 934305777 934305790
Species Human (GRCh38) Human (GRCh38)
Location 2:91820874-91820896 2:91820922-91820944
Sequence CCCGCGGCCTGCACTGATGACCT GACACAGGAAGGGAGGACTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!