ID: 934540963_934540967

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 934540963 934540967
Species Human (GRCh38) Human (GRCh38)
Location 2:95174654-95174676 2:95174673-95174695
Sequence CCTCCCTGCTGGGTTAGGTGAGC GAGCCTCTGAGGTGCTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142} {0: 1, 1: 0, 2: 0, 3: 24, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!