ID: 934625964_934625967

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 934625964 934625967
Species Human (GRCh38) Human (GRCh38)
Location 2:95852391-95852413 2:95852418-95852440
Sequence CCTTCAGTCTGCATATTGTTCAT ACTTTTGTGCTGTAACTGCAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 27, 4: 195} {0: 1, 1: 4, 2: 2, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!