ID: 934641741_934641754

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 934641741 934641754
Species Human (GRCh38) Human (GRCh38)
Location 2:96031001-96031023 2:96031036-96031058
Sequence CCCCATTCCCACCCCTCACCCTG CAGGTTCACAGCCTGAAACACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 13, 3: 143, 4: 1162} {0: 2, 1: 0, 2: 2, 3: 14, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!