ID: 934754821_934754828

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 934754821 934754828
Species Human (GRCh38) Human (GRCh38)
Location 2:96817510-96817532 2:96817543-96817565
Sequence CCCGGGCATGGTGCAGGGGACGC GCCCTCTCCCTGAAAAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 247} {0: 1, 1: 0, 2: 2, 3: 14, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!