ID: 934780832_934780841

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 934780832 934780841
Species Human (GRCh38) Human (GRCh38)
Location 2:96968658-96968680 2:96968682-96968704
Sequence CCATCACCCTCCTCCCAGGGGCC CCTGGCTGTGAGCCCGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 105, 4: 767} {0: 1, 1: 0, 2: 1, 3: 64, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!