ID: 934806585_934806587

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 934806585 934806587
Species Human (GRCh38) Human (GRCh38)
Location 2:97233335-97233357 2:97233369-97233391
Sequence CCAATTATTTGATCCATTTGAAT TGAAAATCTCTTGTGTAAAATGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 38, 4: 333} {0: 4, 1: 0, 2: 6, 3: 37, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!