ID: 934853394_934853397

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 934853394 934853397
Species Human (GRCh38) Human (GRCh38)
Location 2:97714988-97715010 2:97715024-97715046
Sequence CCAGGGCTCTCGGGAGGATAAAG CCACACTGCCCGGCACATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165} {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!