ID: 934853515_934853524

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 934853515 934853524
Species Human (GRCh38) Human (GRCh38)
Location 2:97715594-97715616 2:97715619-97715641
Sequence CCCCGCACCAGCCCAGCTCTCCA GTCTCCTAATAGACATTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 424} {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!