ID: 934860360_934860365

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 934860360 934860365
Species Human (GRCh38) Human (GRCh38)
Location 2:97759472-97759494 2:97759486-97759508
Sequence CCTCTGGGCTGCTGGTGTGGATG GTGTGGATGAGGGAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 357} {0: 1, 1: 0, 2: 7, 3: 150, 4: 1312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!