ID: 934860571_934860579

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 934860571 934860579
Species Human (GRCh38) Human (GRCh38)
Location 2:97760960-97760982 2:97760999-97761021
Sequence CCTGTCTCGGGGAGGTGTGGGGC TGAGTGGGCTTCTCTGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 218} {0: 1, 1: 0, 2: 0, 3: 21, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!