ID: 934869567_934869573

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 934869567 934869573
Species Human (GRCh38) Human (GRCh38)
Location 2:97850461-97850483 2:97850499-97850521
Sequence CCTTGGTAGTGTTGAGACCACCA GAAAAACACACCCTTAATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84} {0: 1, 1: 0, 2: 0, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!