ID: 934902091_934902097

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 934902091 934902097
Species Human (GRCh38) Human (GRCh38)
Location 2:98167556-98167578 2:98167576-98167598
Sequence CCTGAGTTTGGGAGACTGAGCTG CTGAGGGTCTGGAGGGACCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 94, 4: 818} {0: 1, 1: 0, 2: 3, 3: 56, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!