ID: 934910993_934911003

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934910993 934911003
Species Human (GRCh38) Human (GRCh38)
Location 2:98254316-98254338 2:98254362-98254384
Sequence CCACACTCCCAGCCTCCACACTA ACATTTAAGGGGATTGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 867} {0: 1, 1: 0, 2: 3, 3: 24, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!