ID: 934922929_934922939

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934922929 934922939
Species Human (GRCh38) Human (GRCh38)
Location 2:98360139-98360161 2:98360185-98360207
Sequence CCTTCAGCAGCAACCTTAAGGAA CATTTGTAAGAGAGGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161} {0: 1, 1: 0, 2: 4, 3: 45, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!