ID: 934926207_934926219

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 934926207 934926219
Species Human (GRCh38) Human (GRCh38)
Location 2:98383359-98383381 2:98383412-98383434
Sequence CCCTTGATGTTCTCTCTACCTTC CACTAACACCAGCAACAACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 370} {0: 1, 1: 0, 2: 2, 3: 33, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!