ID: 934959569_934959574

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 934959569 934959574
Species Human (GRCh38) Human (GRCh38)
Location 2:98659057-98659079 2:98659102-98659124
Sequence CCAGCATGGAGGGTAGAAGCATC TGACGTTCAACAGTAAGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!