|
Left Crispr |
Right Crispr |
Crispr ID |
934987289 |
934987295 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:98896785-98896807
|
2:98896824-98896846
|
Sequence |
CCTGAAGCCATGGTTTTTAGTTT |
GTGGAAAAGAGGGATGAGGAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 52, 1: 57, 2: 38, 3: 63, 4: 353} |
{0: 24, 1: 33, 2: 46, 3: 144, 4: 1147} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|