ID: 934987289_934987295

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 934987289 934987295
Species Human (GRCh38) Human (GRCh38)
Location 2:98896785-98896807 2:98896824-98896846
Sequence CCTGAAGCCATGGTTTTTAGTTT GTGGAAAAGAGGGATGAGGAAGG
Strand - +
Off-target summary {0: 52, 1: 57, 2: 38, 3: 63, 4: 353} {0: 24, 1: 33, 2: 46, 3: 144, 4: 1147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!