ID: 935112409_935112413

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 935112409 935112413
Species Human (GRCh38) Human (GRCh38)
Location 2:100105096-100105118 2:100105123-100105145
Sequence CCGAGTGCGGGGGGATGCGGAGC CCCGGCCCTGTCGCATCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 87} {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!